Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circZMYM2 | |||
Gene | ZMYM2 | Organism | Human |
Genome Locus | chr13:20633586-20638685:+ | Build | hg19 |
Disease | Pancreatic Cancer | ICD-10 | Malignant neoplasm of Pancreas, unspecified (C25.9) |
DBLink | Link to database | PMID | 30537731 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | PC and their counterpart adjacent tissue samples were obtained from 106 patients |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TTACCACCTGTTTTTGGCGA ReverseCTGGGATATACACAGGCACAGG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
An, Y, Cai, H, Zhang, Y, Liu, S, Duan, Y, Sun, D, Chen, X, He, X (2018). circZMYM2 Competed Endogenously with miR-335-5p to Regulate JMJD2C in Pancreatic Cancer. Cell. Physiol. Biochem., 51, 5:2224-2236. |